Review



mouse 4d9 anti engrailed  (Developmental Studies Hybridoma Bank)


Bioz Verified Symbol Developmental Studies Hybridoma Bank is a verified supplier
Bioz Manufacturer Symbol Developmental Studies Hybridoma Bank manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Developmental Studies Hybridoma Bank mouse 4d9 anti engrailed
    Mouse 4d9 Anti Engrailed, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 90/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/invected/4D9+anti-engrailed%2Finvected/pmc12052134-427-3-6
    Average 90 stars, based on 11 article reviews
    mouse 4d9 anti engrailed - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Redundant function of Runt Domain binding partners, Big brother and Brother, during Drosophila development.
    Article Snippet: A fundamental problem in biology is determining how different cell types are specified during the development of a multicellular organism.. This process is usually initiated by extracellular cues that activate signal transduction cascades which produce a specific cellular response.. Transcription factors such as the Core Binding Factor (CBF) play a vital role in enabling such signaling cascades to regulate a set of target genes (reviewed by Ito, 1999).

    Article Title: How prolonged expression of Hunchback, a temporal transcription factor, re-wires locomotor circuits
    Article Snippet: Antibody , mouse anti-En (monoclonal) , 4D9 , DSHB Cat# 4D9 anti-engrailed/invected, RRID: AB_528224 , 1:5.

    Recombinant:

    Article Title: Spatiotemporal Coordination of FGF and Shh Signaling Underlies the Specification of Myoblasts in the Zebrafish Embryo.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-pax7 antibody DSHB Cat# PAX7; RRID: AB_2299243 (4D9 anti-engrailed/invected) Engrailed Antibody DSHB Cat# 4D9 anti-engrailed/invected; RRID: AB_528224 Rabbit Anti-GFP antibody Torrey Pines Biolabs Cat#:TP401 071519; RRID: AB_10013661 Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat#:A-21121; RRID: AB_141514 Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 Thermo Fisher Scientific Cat#:A-11030; RRID: AB_144695 Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat#:A-21206; RRID: AB_141708 Anti-Digoxigenin-AP, Fab fragments Sigma Aldrich Cat#:11093274910; RRID: AB_2734716 Chemicals, Peptides, and Recombinant Proteins Tricaine Sigma Aldrich Cat#:A5040 SU-5402 Sigma Aldrich Cat#:SML0443 Dorsomorphin Sigma Aldrich Cat#:P5499 Cyclopamine Abcam Cat#:ab120392 Critical Commercial Assays mMESSAGE mMACHINE Transcription SP6 Kit Life Technologies Cat#:AM1340 mMESSAGE mMACHINE Transcription T7 Kit Life Technologies Cat#:AM1341 Transcriptor First Strand cDNA Synthesis Kit Roche Cat#:04379012001 GoTaq Green Master Mix Promega Cat#:M7123 SuperScript! .. III Reverse Transcriptase Thermo Fisher Scientific Cat#:18080044 PrimeSTAR Max DNA Polymerase Clontech Cat#:R045A Fast Red TR/Naphthol AS-MX Tablets Sigma-aldrich Cat#:F4648 Gibson Assembly Master Mix NEB Cat#:E2611L PCR DIG Probe Synthesis Kit Sigma-aldrich Cat#:11636090910 Experimental Models: Organisms/Strains Zebrafish:Tg(PACprdm1:GFP) Ingham Lab, Nanyang Technological University i106Tg Zebrafish:Tg(-10en2a:EGFP) Ingham Lab, Nanyang Technological University i233Tg Zebrafish:Tg(smyhc1:GAL4-VP16) Ingham Lab, Nanyang Technological University i316Tg Zebrafish: Tg(hsp70:ca-fgfr1)pd3 Poss Lab, Duke University pd3Tg Zebrafish: Tg(hsp70l:dnfgfr1a-EGFP)pd1 Poss Lab, Duke University pd1Tg Zebrafish: smob641/b641 Westerfield Lab, University of Oregon b641 Zebrafish: prdm1atp39/tp39 N€usslein-Volhard Lab, Max Planck Institute for Developmental Biology tp39 Zebrafish: tbx6ti1/ti1 N€usslein-Volhard Lab, Max Planck Institute for Developmental Biology ti1 Oligonucleotides pea3_R TAATACGACTCACTATAGgctca ccagccaccttttgc N/A pea3_F ctggaccagcaagtgccttatact N/A spry4_R TAATACGACTCACTATAGGgtttt tctggctgacaggcct N/A (Continued on next page) Developmental Cell 46, 735–750.e1–e4, September 24, 2018 e1

    cDNA Synthesis:

    Article Title: Spatiotemporal Coordination of FGF and Shh Signaling Underlies the Specification of Myoblasts in the Zebrafish Embryo.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-pax7 antibody DSHB Cat# PAX7; RRID: AB_2299243 (4D9 anti-engrailed/invected) Engrailed Antibody DSHB Cat# 4D9 anti-engrailed/invected; RRID: AB_528224 Rabbit Anti-GFP antibody Torrey Pines Biolabs Cat#:TP401 071519; RRID: AB_10013661 Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat#:A-21121; RRID: AB_141514 Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 Thermo Fisher Scientific Cat#:A-11030; RRID: AB_144695 Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat#:A-21206; RRID: AB_141708 Anti-Digoxigenin-AP, Fab fragments Sigma Aldrich Cat#:11093274910; RRID: AB_2734716 Chemicals, Peptides, and Recombinant Proteins Tricaine Sigma Aldrich Cat#:A5040 SU-5402 Sigma Aldrich Cat#:SML0443 Dorsomorphin Sigma Aldrich Cat#:P5499 Cyclopamine Abcam Cat#:ab120392 Critical Commercial Assays mMESSAGE mMACHINE Transcription SP6 Kit Life Technologies Cat#:AM1340 mMESSAGE mMACHINE Transcription T7 Kit Life Technologies Cat#:AM1341 Transcriptor First Strand cDNA Synthesis Kit Roche Cat#:04379012001 GoTaq Green Master Mix Promega Cat#:M7123 SuperScript! .. III Reverse Transcriptase Thermo Fisher Scientific Cat#:18080044 PrimeSTAR Max DNA Polymerase Clontech Cat#:R045A Fast Red TR/Naphthol AS-MX Tablets Sigma-aldrich Cat#:F4648 Gibson Assembly Master Mix NEB Cat#:E2611L PCR DIG Probe Synthesis Kit Sigma-aldrich Cat#:11636090910 Experimental Models: Organisms/Strains Zebrafish:Tg(PACprdm1:GFP) Ingham Lab, Nanyang Technological University i106Tg Zebrafish:Tg(-10en2a:EGFP) Ingham Lab, Nanyang Technological University i233Tg Zebrafish:Tg(smyhc1:GAL4-VP16) Ingham Lab, Nanyang Technological University i316Tg Zebrafish: Tg(hsp70:ca-fgfr1)pd3 Poss Lab, Duke University pd3Tg Zebrafish: Tg(hsp70l:dnfgfr1a-EGFP)pd1 Poss Lab, Duke University pd1Tg Zebrafish: smob641/b641 Westerfield Lab, University of Oregon b641 Zebrafish: prdm1atp39/tp39 N€usslein-Volhard Lab, Max Planck Institute for Developmental Biology tp39 Zebrafish: tbx6ti1/ti1 N€usslein-Volhard Lab, Max Planck Institute for Developmental Biology ti1 Oligonucleotides pea3_R TAATACGACTCACTATAGgctca ccagccaccttttgc N/A pea3_F ctggaccagcaagtgccttatact N/A spry4_R TAATACGACTCACTATAGGgtttt tctggctgacaggcct N/A (Continued on next page) Developmental Cell 46, 735–750.e1–e4, September 24, 2018 e1

    Binding Assay:

    Article Title: Multi-level and lineage-specific interactomes of the Hox transcription factor Ubx contribute to its functional specificity
    Article Snippet: The antibodies used in this study were: -Histone 3, Abcam, reference: 1791, -GFP, Life Technologies, reference: A11122, -Streptavidin-HRP, GE-healthcare, reference: RPN1231, 3 n atu re research | rep o rtin g su m m ary O cto ber2018 Validation -Tubulin, Serotec/Biorad, reference: MCA77G, -HA, Cell Signaling, reference: 3724, -GST, Cell Signaling, reference: 2624, -Flag-M2, Sigma, reference: F1804, -V5, Cell Signaling, reference:13202, -MBP, Cell Signaling, reference: 2396, -Myc, Santa Cruz, reference: SC40, -Beta-Galactosidase, Promega, reference Z3783, -Tropomyosin 1 (Tm1), Abcam, reference: ab50567, -Ubx, home-made, Ingrid Lohmann lab (COS-Heidelberg University) -Deadpan (Dpn), originally from Jürgen Knoblich (IMBA, Austria), generously provided by Ana Rogulja-Ortmann (COS, Heidelberg). .. -Grainy Head (Grh), generously provided by Bill McGinnis (UCSD, San Diego), -Tinman (Tin), generously provided by Manfred Frasch (FAU Department Biology, Erlangen), -Zelda (Zld), generously provided by Julia Zeitlinger, (Stowers Institute for Medical Research, Missouri), -C-terminal Binding Protein (CtBP), generously provided by David Arnosti (Michigan State University), -Combgap (Cg), generously provided by William Brook (University of Calgary, Canada), -Med19, generously provided by Muriel Boube (Paul Sabatier University - Toulouse III), -Polycomb (Pc), generously provided by Jürg Müller (MPI of Biochemistry, Munich), -Motif Binding Protein (M1BP), originally from D. Gilmour (Center for Eukaryotic Gene Regulation, Pennsylvania) generously provided by Andy Saurin (IBDM, Marseille), -Engrailed 4D9 anti-engrailed/invected was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 4D9 antiengrailed/invected), -1D4 anti-Fasciclin 2 was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 1D4 anti-Fasciclin 2), -Rat-Elav-7E8A10 anti-elav was deposited to the DSHB by Rubin, G.M. (DSHB Hybridoma Product Rat-Elav-7E8A10 anti-elav), Validation acronyms: Immunoprecipitation (IP), immunofluorescence (IF), Western-blot (WB), ImmunoHistoChemistry (IHC). .. -Histone 3, statement from Abcam: validated for IHC-Fr, CHIPseq, Dot blot, flow cytometry, IHC-P, Electron Microscopy, ICC/IF, ChIP, IP, WB, ChIP/Chip, IHC-Wholemount, ICC -GFP, statement from Life Technologies: validated for IF, WB.

    Biomarker Discovery:

    Article Title: Multi-level and lineage-specific interactomes of the Hox transcription factor Ubx contribute to its functional specificity
    Article Snippet: The antibodies used in this study were: -Histone 3, Abcam, reference: 1791, -GFP, Life Technologies, reference: A11122, -Streptavidin-HRP, GE-healthcare, reference: RPN1231, 3 n atu re research | rep o rtin g su m m ary O cto ber2018 Validation -Tubulin, Serotec/Biorad, reference: MCA77G, -HA, Cell Signaling, reference: 3724, -GST, Cell Signaling, reference: 2624, -Flag-M2, Sigma, reference: F1804, -V5, Cell Signaling, reference:13202, -MBP, Cell Signaling, reference: 2396, -Myc, Santa Cruz, reference: SC40, -Beta-Galactosidase, Promega, reference Z3783, -Tropomyosin 1 (Tm1), Abcam, reference: ab50567, -Ubx, home-made, Ingrid Lohmann lab (COS-Heidelberg University) -Deadpan (Dpn), originally from Jürgen Knoblich (IMBA, Austria), generously provided by Ana Rogulja-Ortmann (COS, Heidelberg). .. -Grainy Head (Grh), generously provided by Bill McGinnis (UCSD, San Diego), -Tinman (Tin), generously provided by Manfred Frasch (FAU Department Biology, Erlangen), -Zelda (Zld), generously provided by Julia Zeitlinger, (Stowers Institute for Medical Research, Missouri), -C-terminal Binding Protein (CtBP), generously provided by David Arnosti (Michigan State University), -Combgap (Cg), generously provided by William Brook (University of Calgary, Canada), -Med19, generously provided by Muriel Boube (Paul Sabatier University - Toulouse III), -Polycomb (Pc), generously provided by Jürg Müller (MPI of Biochemistry, Munich), -Motif Binding Protein (M1BP), originally from D. Gilmour (Center for Eukaryotic Gene Regulation, Pennsylvania) generously provided by Andy Saurin (IBDM, Marseille), -Engrailed 4D9 anti-engrailed/invected was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 4D9 antiengrailed/invected), -1D4 anti-Fasciclin 2 was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 1D4 anti-Fasciclin 2), -Rat-Elav-7E8A10 anti-elav was deposited to the DSHB by Rubin, G.M. (DSHB Hybridoma Product Rat-Elav-7E8A10 anti-elav), Validation acronyms: Immunoprecipitation (IP), immunofluorescence (IF), Western-blot (WB), ImmunoHistoChemistry (IHC). .. -Histone 3, statement from Abcam: validated for IHC-Fr, CHIPseq, Dot blot, flow cytometry, IHC-P, Electron Microscopy, ICC/IF, ChIP, IP, WB, ChIP/Chip, IHC-Wholemount, ICC -GFP, statement from Life Technologies: validated for IF, WB.

    Immunoprecipitation:

    Article Title: Multi-level and lineage-specific interactomes of the Hox transcription factor Ubx contribute to its functional specificity
    Article Snippet: The antibodies used in this study were: -Histone 3, Abcam, reference: 1791, -GFP, Life Technologies, reference: A11122, -Streptavidin-HRP, GE-healthcare, reference: RPN1231, 3 n atu re research | rep o rtin g su m m ary O cto ber2018 Validation -Tubulin, Serotec/Biorad, reference: MCA77G, -HA, Cell Signaling, reference: 3724, -GST, Cell Signaling, reference: 2624, -Flag-M2, Sigma, reference: F1804, -V5, Cell Signaling, reference:13202, -MBP, Cell Signaling, reference: 2396, -Myc, Santa Cruz, reference: SC40, -Beta-Galactosidase, Promega, reference Z3783, -Tropomyosin 1 (Tm1), Abcam, reference: ab50567, -Ubx, home-made, Ingrid Lohmann lab (COS-Heidelberg University) -Deadpan (Dpn), originally from Jürgen Knoblich (IMBA, Austria), generously provided by Ana Rogulja-Ortmann (COS, Heidelberg). .. -Grainy Head (Grh), generously provided by Bill McGinnis (UCSD, San Diego), -Tinman (Tin), generously provided by Manfred Frasch (FAU Department Biology, Erlangen), -Zelda (Zld), generously provided by Julia Zeitlinger, (Stowers Institute for Medical Research, Missouri), -C-terminal Binding Protein (CtBP), generously provided by David Arnosti (Michigan State University), -Combgap (Cg), generously provided by William Brook (University of Calgary, Canada), -Med19, generously provided by Muriel Boube (Paul Sabatier University - Toulouse III), -Polycomb (Pc), generously provided by Jürg Müller (MPI of Biochemistry, Munich), -Motif Binding Protein (M1BP), originally from D. Gilmour (Center for Eukaryotic Gene Regulation, Pennsylvania) generously provided by Andy Saurin (IBDM, Marseille), -Engrailed 4D9 anti-engrailed/invected was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 4D9 antiengrailed/invected), -1D4 anti-Fasciclin 2 was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 1D4 anti-Fasciclin 2), -Rat-Elav-7E8A10 anti-elav was deposited to the DSHB by Rubin, G.M. (DSHB Hybridoma Product Rat-Elav-7E8A10 anti-elav), Validation acronyms: Immunoprecipitation (IP), immunofluorescence (IF), Western-blot (WB), ImmunoHistoChemistry (IHC). .. -Histone 3, statement from Abcam: validated for IHC-Fr, CHIPseq, Dot blot, flow cytometry, IHC-P, Electron Microscopy, ICC/IF, ChIP, IP, WB, ChIP/Chip, IHC-Wholemount, ICC -GFP, statement from Life Technologies: validated for IF, WB.

    Immunofluorescence:

    Article Title: Multi-level and lineage-specific interactomes of the Hox transcription factor Ubx contribute to its functional specificity
    Article Snippet: The antibodies used in this study were: -Histone 3, Abcam, reference: 1791, -GFP, Life Technologies, reference: A11122, -Streptavidin-HRP, GE-healthcare, reference: RPN1231, 3 n atu re research | rep o rtin g su m m ary O cto ber2018 Validation -Tubulin, Serotec/Biorad, reference: MCA77G, -HA, Cell Signaling, reference: 3724, -GST, Cell Signaling, reference: 2624, -Flag-M2, Sigma, reference: F1804, -V5, Cell Signaling, reference:13202, -MBP, Cell Signaling, reference: 2396, -Myc, Santa Cruz, reference: SC40, -Beta-Galactosidase, Promega, reference Z3783, -Tropomyosin 1 (Tm1), Abcam, reference: ab50567, -Ubx, home-made, Ingrid Lohmann lab (COS-Heidelberg University) -Deadpan (Dpn), originally from Jürgen Knoblich (IMBA, Austria), generously provided by Ana Rogulja-Ortmann (COS, Heidelberg). .. -Grainy Head (Grh), generously provided by Bill McGinnis (UCSD, San Diego), -Tinman (Tin), generously provided by Manfred Frasch (FAU Department Biology, Erlangen), -Zelda (Zld), generously provided by Julia Zeitlinger, (Stowers Institute for Medical Research, Missouri), -C-terminal Binding Protein (CtBP), generously provided by David Arnosti (Michigan State University), -Combgap (Cg), generously provided by William Brook (University of Calgary, Canada), -Med19, generously provided by Muriel Boube (Paul Sabatier University - Toulouse III), -Polycomb (Pc), generously provided by Jürg Müller (MPI of Biochemistry, Munich), -Motif Binding Protein (M1BP), originally from D. Gilmour (Center for Eukaryotic Gene Regulation, Pennsylvania) generously provided by Andy Saurin (IBDM, Marseille), -Engrailed 4D9 anti-engrailed/invected was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 4D9 antiengrailed/invected), -1D4 anti-Fasciclin 2 was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 1D4 anti-Fasciclin 2), -Rat-Elav-7E8A10 anti-elav was deposited to the DSHB by Rubin, G.M. (DSHB Hybridoma Product Rat-Elav-7E8A10 anti-elav), Validation acronyms: Immunoprecipitation (IP), immunofluorescence (IF), Western-blot (WB), ImmunoHistoChemistry (IHC). .. -Histone 3, statement from Abcam: validated for IHC-Fr, CHIPseq, Dot blot, flow cytometry, IHC-P, Electron Microscopy, ICC/IF, ChIP, IP, WB, ChIP/Chip, IHC-Wholemount, ICC -GFP, statement from Life Technologies: validated for IF, WB.

    Western Blot:

    Article Title: Multi-level and lineage-specific interactomes of the Hox transcription factor Ubx contribute to its functional specificity
    Article Snippet: The antibodies used in this study were: -Histone 3, Abcam, reference: 1791, -GFP, Life Technologies, reference: A11122, -Streptavidin-HRP, GE-healthcare, reference: RPN1231, 3 n atu re research | rep o rtin g su m m ary O cto ber2018 Validation -Tubulin, Serotec/Biorad, reference: MCA77G, -HA, Cell Signaling, reference: 3724, -GST, Cell Signaling, reference: 2624, -Flag-M2, Sigma, reference: F1804, -V5, Cell Signaling, reference:13202, -MBP, Cell Signaling, reference: 2396, -Myc, Santa Cruz, reference: SC40, -Beta-Galactosidase, Promega, reference Z3783, -Tropomyosin 1 (Tm1), Abcam, reference: ab50567, -Ubx, home-made, Ingrid Lohmann lab (COS-Heidelberg University) -Deadpan (Dpn), originally from Jürgen Knoblich (IMBA, Austria), generously provided by Ana Rogulja-Ortmann (COS, Heidelberg). .. -Grainy Head (Grh), generously provided by Bill McGinnis (UCSD, San Diego), -Tinman (Tin), generously provided by Manfred Frasch (FAU Department Biology, Erlangen), -Zelda (Zld), generously provided by Julia Zeitlinger, (Stowers Institute for Medical Research, Missouri), -C-terminal Binding Protein (CtBP), generously provided by David Arnosti (Michigan State University), -Combgap (Cg), generously provided by William Brook (University of Calgary, Canada), -Med19, generously provided by Muriel Boube (Paul Sabatier University - Toulouse III), -Polycomb (Pc), generously provided by Jürg Müller (MPI of Biochemistry, Munich), -Motif Binding Protein (M1BP), originally from D. Gilmour (Center for Eukaryotic Gene Regulation, Pennsylvania) generously provided by Andy Saurin (IBDM, Marseille), -Engrailed 4D9 anti-engrailed/invected was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 4D9 antiengrailed/invected), -1D4 anti-Fasciclin 2 was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 1D4 anti-Fasciclin 2), -Rat-Elav-7E8A10 anti-elav was deposited to the DSHB by Rubin, G.M. (DSHB Hybridoma Product Rat-Elav-7E8A10 anti-elav), Validation acronyms: Immunoprecipitation (IP), immunofluorescence (IF), Western-blot (WB), ImmunoHistoChemistry (IHC). .. -Histone 3, statement from Abcam: validated for IHC-Fr, CHIPseq, Dot blot, flow cytometry, IHC-P, Electron Microscopy, ICC/IF, ChIP, IP, WB, ChIP/Chip, IHC-Wholemount, ICC -GFP, statement from Life Technologies: validated for IF, WB.

    Immunohistochemistry:

    Article Title: Multi-level and lineage-specific interactomes of the Hox transcription factor Ubx contribute to its functional specificity
    Article Snippet: The antibodies used in this study were: -Histone 3, Abcam, reference: 1791, -GFP, Life Technologies, reference: A11122, -Streptavidin-HRP, GE-healthcare, reference: RPN1231, 3 n atu re research | rep o rtin g su m m ary O cto ber2018 Validation -Tubulin, Serotec/Biorad, reference: MCA77G, -HA, Cell Signaling, reference: 3724, -GST, Cell Signaling, reference: 2624, -Flag-M2, Sigma, reference: F1804, -V5, Cell Signaling, reference:13202, -MBP, Cell Signaling, reference: 2396, -Myc, Santa Cruz, reference: SC40, -Beta-Galactosidase, Promega, reference Z3783, -Tropomyosin 1 (Tm1), Abcam, reference: ab50567, -Ubx, home-made, Ingrid Lohmann lab (COS-Heidelberg University) -Deadpan (Dpn), originally from Jürgen Knoblich (IMBA, Austria), generously provided by Ana Rogulja-Ortmann (COS, Heidelberg). .. -Grainy Head (Grh), generously provided by Bill McGinnis (UCSD, San Diego), -Tinman (Tin), generously provided by Manfred Frasch (FAU Department Biology, Erlangen), -Zelda (Zld), generously provided by Julia Zeitlinger, (Stowers Institute for Medical Research, Missouri), -C-terminal Binding Protein (CtBP), generously provided by David Arnosti (Michigan State University), -Combgap (Cg), generously provided by William Brook (University of Calgary, Canada), -Med19, generously provided by Muriel Boube (Paul Sabatier University - Toulouse III), -Polycomb (Pc), generously provided by Jürg Müller (MPI of Biochemistry, Munich), -Motif Binding Protein (M1BP), originally from D. Gilmour (Center for Eukaryotic Gene Regulation, Pennsylvania) generously provided by Andy Saurin (IBDM, Marseille), -Engrailed 4D9 anti-engrailed/invected was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 4D9 antiengrailed/invected), -1D4 anti-Fasciclin 2 was deposited to the DSHB by Goodman, C. (DSHB Hybridoma Product 1D4 anti-Fasciclin 2), -Rat-Elav-7E8A10 anti-elav was deposited to the DSHB by Rubin, G.M. (DSHB Hybridoma Product Rat-Elav-7E8A10 anti-elav), Validation acronyms: Immunoprecipitation (IP), immunofluorescence (IF), Western-blot (WB), ImmunoHistoChemistry (IHC). .. -Histone 3, statement from Abcam: validated for IHC-Fr, CHIPseq, Dot blot, flow cytometry, IHC-P, Electron Microscopy, ICC/IF, ChIP, IP, WB, ChIP/Chip, IHC-Wholemount, ICC -GFP, statement from Life Technologies: validated for IF, WB.



    Similar Products

    mouse 4d9 anti engrailed  (Developmental Studies Hybridoma Bank)
    90
    Developmental Studies Hybridoma Bank mouse 4d9 anti engrailed
    Mouse 4d9 Anti Engrailed, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/invected/4D9+anti-engrailed%2Finvected/pmc12052134-427-3-6
    Average 90 stars, based on 1 article reviews
    mouse 4d9 anti engrailed - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    celsus s invectives  (Celsus Laboratories)
    86
    Celsus Laboratories celsus s invectives
    Celsus S Invectives, supplied by Celsus Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/invected/celsus+invectives+s/10__47456_slash_pbnj0f48-18-11-11
    Average 86 stars, based on 1 article reviews
    celsus s invectives - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    4d9  (Developmental Studies Hybridoma Bank)
    90
    Developmental Studies Hybridoma Bank 4d9
    4d9, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/invected/4D9+anti-engrailed%2Finvected/pm39792672-327-61-62
    Average 90 stars, based on 1 article reviews
    4d9 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    dshb 4d9  (Developmental Studies Hybridoma Bank)
    90
    Developmental Studies Hybridoma Bank dshb 4d9
    Dshb 4d9, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/invected/4D9+anti-engrailed%2Finvected/pm39465887-233-8-8
    Average 90 stars, based on 1 article reviews
    dshb 4d9 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    anti engrailed 4d9  (Developmental Studies Hybridoma Bank)
    90
    Developmental Studies Hybridoma Bank anti engrailed 4d9

    Anti Engrailed 4d9, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/invected/4D9+anti-engrailed%2Finvected/pmc11536050-10-0-19
    Average 90 stars, based on 1 article reviews
    anti engrailed 4d9 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    mouse anti engrailed en  (Developmental Studies Hybridoma Bank)
    90
    Developmental Studies Hybridoma Bank mouse anti engrailed en

    Mouse Anti Engrailed En, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/invected/4D9+anti-engrailed%2Finvected/pmc11171731-211-31-35
    Average 90 stars, based on 1 article reviews
    mouse anti engrailed en - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    anti engrailed  (Developmental Studies Hybridoma Bank)
    90
    Developmental Studies Hybridoma Bank anti engrailed

    Anti Engrailed, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/invected/4D9+anti-engrailed%2Finvected/bio_rxiv__2023__09__19__557849-96-18-23
    Average 90 stars, based on 1 article reviews
    anti engrailed - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    mouse anti en 4d9  (Developmental Studies Hybridoma Bank)
    95
    Developmental Studies Hybridoma Bank mouse anti en 4d9

    Mouse Anti En 4d9, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/invected/4D9+anti-engrailed%2Finvected/pmc10504328-264-19-23
    Average 95 stars, based on 1 article reviews
    mouse anti en 4d9 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: microPublication Biology

    Article Title: Identification of a novel downstream single-minded midline regulatory element in Drosophila melanogaster

    doi: 10.17912/micropub.biology.001317

    Figure Lengend Snippet:

    Article Snippet: anti-Engrailed 4D9 , Mouse; monoclonal , Antibody recognizes both the Engrailed and Invected gene products of Drosophila . , Developmental Studies Hybridoma Bank.

    Techniques: Sequencing, Recombinant, Plasmid Preparation